ENSDARG00000086404

Ensembl ID:
ENSDARG00000086404

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44862 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36266 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125304 Essential Splice Site 93 253 3 6
Genomic Location (Zv9):
Chromosome 16 (position 56302956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACTCCAAGAGTGGTTTTTGGTGAAAGAGGAGAAATTGCCAGACGGGG[T/A]AAGTCTGTTTATTCAGCACATTACATGAAATATGCACTGTAAGAGGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125304 Essential Splice Site 220 253 5 6
Genomic Location (Zv9):
Chromosome 16 (position 56303729)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52814420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACCATCGTGGAGGGCATAGCAAGACATTGTTCCAGCATACCTACAGG[T/G]AAGAAGACTACTCTAATGGCCTGTTTCCACTGAGTTGTACAGTGCGGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link