FMN1 (2 of 3)

Ensembl ID:
ENSDARG00000086384
Description:
formin 1 [Source:HGNC Symbol;Acc:3768]
Human Orthologue:
FMN1
Human Description:
formin 1 [Source:HGNC Symbol;Acc:3768]
Mouse Orthologue:
Fmn1
Mouse Description:
formin 1 Gene [Source:MGI Symbol;Acc:MGI:101815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24825 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130502 Essential Splice Site 149 258 5 8
Genomic Location:
Chromosome Zv9_NA233 (position 34321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGATTTGGACTGGAGATTCTGCCTAAATTAAAAGACGTCAAGAGCAGG[G/T]TAACCAAAAGCAAACACACCCAAAGCTGCACTAAATATACGGTTGGAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
  • Orofacial clefts: Genome-wide association study identifies two susceptibility loci for nonsyndromic cleft lip with or without cleft palate. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1vbczsgy