si:ch211-232d10.3

Ensembl ID:
ENSDARG00000086379
ZFIN IDs:
ZDB-GENE-050417-391, ZDB-GENE-080206-3, ZDB-GENE-081103-4
Description:
Zgc:110171 [Source:UniProtKB/TrEMBL;Acc:Q568Q2]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26371 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111357   None 244 None 9
ENSDART00000135011 Nonsense 820 892 8 8
ENSDART00000139528   None 770 None 6
Genomic Location (Zv9):
Chromosome 4 (position 61559017)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 74468008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGTTTGGATATAATGCTCAGTCCTGGAGTTTGTTCTGTGATTCCTCC[A/T]GATTCATATTCTGGCACAATAACACACACACTGTTCTCCCAGTGAAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link