si:ch211-124o16.3

Ensembl ID:
ENSDARG00000086362
ZFIN ID:
ZDB-GENE-091118-71
Human Orthologue:
POU6F2
Human Description:
POU class 6 homeobox 2 [Source:HGNC Symbol;Acc:21694]
Mouse Orthologue:
Pou6f2
Mouse Description:
POU domain, class 6, transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:2443631]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10016 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126668 Nonsense 416 694 6 9
ENSDART00000144186 Nonsense 117 395 2 5

The following transcripts of ENSDARG00000086362 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 10038223)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10097107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAGTGATCAACACCCAGGGAATCAMACTGTCACCCATTAAACCTGGA[C/T]AACAGGTAYACAACATATTCTGGCTATTTCTGCAAGAGAATCCTGTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link