LOC100332526

Ensembl ID:
ENSDARG00000086356
Human Orthologue:
ARAP1
Human Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 [Source:HGNC Symbol;Acc:16925]
Mouse Orthologue:
Arap1
Mouse Description:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 Gene [Source:MGI Symbol;Acc:MGI:1916960]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5616 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa5616
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128673 Essential Splice Site 27 458 3 14
Genomic Location:
Chromosome 15 (position 46686900)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATNNNNNNNNNNNNNTGTGTGTGTGTGTGTGTGTGTGTGCAGGACGTGTACTCAAA[G/A]AGGATCATCTCGACGGCCTCCAKCACTGATGTGGTGATTGTGGGAGATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/utl7d900