C1orf159

Ensembl ID:
ENSDARG00000086336
Description:
chromosome 1 open reading frame 159 [Source:HGNC Symbol;Acc:26062]
Human Orthologue:
C1orf159
Human Description:
chromosome 1 open reading frame 159 [Source:HGNC Symbol;Acc:26062]
Mouse Orthologue:
9430015G10Rik
Mouse Description:
RIKEN cDNA 9430015G10 gene Gene [Source:MGI Symbol;Acc:MGI:2444364]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40764 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122550 Essential Splice Site 78 149 3 7
Genomic Location (Zv9):
Chromosome 6 (position 40642944)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40714544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCCCTGTGCCTCAGCAGACCAGGGGAATTCAACTTCACTTAACAGTA[G/A]TAAGTGGACATTAGCTGTAAAGTATTGATGATTGCATATACAATGGACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link