si:ch211-67e16.4

Ensembl ID:
ENSDARG00000086317
ZFIN ID:
ZDB-GENE-070912-311

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41379 Nonsense Mutation detected in F1 DNA During 2017
sa34584 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124267 Nonsense 375 496 4 6
ENSDART00000134603   None 201 None 2
ENSDART00000140199   None 256 None 2
ENSDART00000142749   None 246 None 3
Genomic Location (Zv9):
Chromosome 9 (position 14313741)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14066306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCAACCGCCTGACCACATTAGTTCAATATCTTGTTGGAAACACGGTC[C/T]AGCCAGAAGAAGAGGAAAACGACTGCATCTTGCCTGTGACGTCAATGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124267 Essential Splice Site 463 496 5 6
ENSDART00000134603   None 201 None 2
ENSDART00000140199   None 256 None 2
ENSDART00000142749   None 246 None 3
Genomic Location (Zv9):
Chromosome 9 (position 14314082)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14066647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGACAAACGAGGCTTGAGAAAAACAAATATTGGAGCTGTAATAATAGG[T/G]ATGTCCGAATCAACATCTTTATTTAAGAATCGAACCGTGGCTCACTGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link