ENSDARG00000086308

Ensembl ID:
ENSDARG00000086308

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35186 Nonsense Mutation detected in F1 DNA During 2016
sa27862 Nonsense Mutation detected in F1 DNA During 2016
sa24901 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126772 Nonsense 236 437 1 1
Genomic Location:
Chromosome 12 (position 3990156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGTACCACTGCTGTATGTTGCTGTATTCTGCTGTATGTTGCTGTA[T/A]TCTGCTGTATTTTGCGGTATCACTGATGTATGTTGCTGTATTCTACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126772 Nonsense 396 437 1 1
Genomic Location:
Chromosome 12 (position 3990636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTGCTGTATGTTGCTGTGTTCTGCTATATTTTGCGGTACCAATGCTG[T/A]ATGTTGCTGTATTCAGATATATTTTGCGGTACCACTGCTGTATGTTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126772 Nonsense 412 437 1 1
Genomic Location:
Chromosome 12 (position 3990684)
KASP Assay ID:
554-7861.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATGTTGCTGTATTCAGATATATTTTGCGGTACCACTGCTGTATGTTG[C/A]TGTATTCTGCTGTATTTTGCGGTACCACTGCTGTATGTTGCTGTATTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link