ENSDARG00000086305

Ensembl ID:
ENSDARG00000086305
Human Orthologue:
KIF9
Human Description:
kinesin family member 9 [Source:HGNC Symbol;Acc:16666]
Mouse Orthologue:
Kif9
Mouse Description:
kinesin family member 9 Gene [Source:MGI Symbol;Acc:MGI:1098237]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18261 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122415 Essential Splice Site 27 506 1 10
Genomic Location:
Chromosome 17 (position 23835108)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCAAGAGACCAAGATGCTGAAACGCTCCCTCACCATATTCGGAAATG[T/G]TAGTAAAACCTCAAACATGTCAGCACACACTCACAAAAAAGCAYGTACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yw5yg7hb