C13orf23

Ensembl ID:
ENSDARG00000086302
Description:
chromosome 13 open reading frame 23 [Source:HGNC Symbol;Acc:20291]
Human Orthologue:
C13orf23
Human Description:
chromosome 13 open reading frame 23 [Source:HGNC Symbol;Acc:20291]
Mouse Orthologue:
2810046L04Rik
Mouse Description:
RIKEN cDNA 2810046L04 gene Gene [Source:MGI Symbol;Acc:MGI:1919933]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14605 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128902 Nonsense 742 772 11 11
Genomic Location:
Chromosome 10 (position 25082139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTTGGTTGTCATTTCAGGCTCACTCAGCATCAGCACTGGACAGTTA[C/A]GCTCAGCCAAATGGATTCCCAAACTACCCAGCAGCAGCTGGCTCAAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3zi87dhw