ENSDARG00000086298

Ensembl ID:
ENSDARG00000086298
Human Orthologue:
DNAH11
Human Description:
dynein, axonemal, heavy chain 11 [Source:HGNC Symbol;Acc:2942]
Mouse Orthologue:
Dnahc11
Mouse Description:
dynein, axonemal, heavy chain 11 Gene [Source:MGI Symbol;Acc:MGI:1100864]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30419 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38205 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124466 Essential Splice Site 143 479 3 11
Genomic Location (Zv9):
Chromosome Zv9_NA667 (position 9246)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10434830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCGATATTCTTCATCAGACTAGAGGAGCCCTACAAACTCATTGACAAG[G/T]TACTTTTGTGTTTTTATTTCTGAGTGTGTTTTCAACTCATTGCCAAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124466 Essential Splice Site 143 479 3 11
Genomic Location (Zv9):
Chromosome Zv9_NA667 (position 9245)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10434829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGATATTCTTCATCAGACTAGAGGAGCCCTACAAACTCATTGACAAGG[T/C]ACTTTTGTGTTTTTATTTCTGAGTGTGTTTTCAACTCATTGCCAAAGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link