si:busm1-228j01.3

Ensembl ID:
ENSDARG00000086294
ZFIN IDs:
ZDB-GENE-030616-393, ZDB-GENE-030616-447
Description:
Novel protein similar to MHC class II alpha chain [Source:UniProtKB/TrEMBL;Acc:A3KFP9]
Human Orthologues:
HLA-DMA, HLA-DMB, HLA-DOA, HLA-DPA1, HLA-DQA1, HLA-DQA2, HLA-DRA, XXbac-BPG181M17.5
Human Descriptions:
major histocompatibility complex, class II, DM alpha [Source:HGNC Symbol;Acc:4934]
major histocompatibility complex, class II, DM beta [Source:HGNC Symbol;Acc:4935]
Major histocompatibility complex, class II, DM beta [Source:UniProtKB/TrEMBL;Acc:A2AAT6]
major histocompatibility complex, class II, DO alpha [Source:HGNC Symbol;Acc:4936]
major histocompatibility complex, class II, DP alpha 1 [Source:HGNC Symbol;Acc:4938]
major histocompatibility complex, class II, DQ alpha 1 [Source:HGNC Symbol;Acc:4942]
major histocompatibility complex, class II, DQ alpha 2 [Source:HGNC Symbol;Acc:4943]
major histocompatibility complex, class II, DR alpha [Source:HGNC Symbol;Acc:4947]
Mouse Orthologues:
H2-Aa, H2-DMa, H2-DMb1, H2-DMb2, H2-Oa
Mouse Descriptions:
histocompatibility 2, class II antigen A, alpha Gene [Source:MGI Symbol;Acc:MGI:95895]
histocompatibility 2, class II, locus DMa Gene [Source:MGI Symbol;Acc:MGI:95921]
histocompatibility 2, class II, locus Mb1 Gene [Source:MGI Symbol;Acc:MGI:95922]
histocompatibility 2, class II, locus Mb2 Gene [Source:MGI Symbol;Acc:MGI:95923]
histocompatibility 2, O region alpha locus Gene [Source:MGI Symbol;Acc:MGI:95924]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21363 Nonsense Available for shipment Available now
sa11984 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129901 Nonsense 159 259 3 4
Genomic Location (Zv9):
Chromosome 8 (position 45778479)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44365078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGAACACTCTGATCTGTCATGTGACTGGATTCTTCCCTCCACCGGTC[A/T]GAGTCTTGTGGACCAAGAACAATGTGAATGTGACAGATGGGTCAACTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129901 Nonsense 177 259 3 4
Genomic Location (Zv9):
Chromosome 8 (position 45778425)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44365132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGTGGACCAAGAACAATGTGAATGTGACAGATGGGTCAACTATCAGC[A/T]GATATTACCCWGACAATGATAGAAATTTTAATGWCTTTTCTCAACTGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link