si:ch1073-376g14.1

Ensembl ID:
ENSDARG00000086290
ZFIN ID:
ZDB-GENE-100922-265
Human Orthologue:
ZNF804B
Human Description:
zinc finger protein 804B [Source:HGNC Symbol;Acc:21958]
Mouse Orthologue:
AC112662.1
Mouse Description:
zinc finger protein 804B [Source:RefSeq peptide;Acc:NP_001156695]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30689 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11375 Nonsense Available for shipment Available now
sa28674 Nonsense Mutation detected in F1 DNA During 2017
sa42736 Nonsense Mutation detected in F1 DNA During 2017
sa10089 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Essential Splice Site 39 1271 2 4
ENSDART00000133696   1 89 1 2
Genomic Location (Zv9):
Chromosome 16 (position 30186045)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28023183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATGCATAACCAACAGTCTCTTTCTCTCTCTTTCTCTCTCTCTGTTTT[A/C]GGACTACGCTAAGAAAGAGAAAGCCATTGCAAAAGCCCTGGGGGATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Nonsense 110 1271 3 4
ENSDART00000133696 Nonsense 72 89 2 2
Genomic Location (Zv9):
Chromosome 16 (position 30227041)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28064179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGAATTTGCACGGAATGTTTCCTCCAAGTCTTGGAAAGATGAAAAA[A/T]AGCARAAACGWGCTCTGAAACGACTGCATCAGCTTGCACAACTCAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Nonsense 868 1271 4 4
ENSDART00000133696   None 89 None 2
Genomic Location (Zv9):
Chromosome 16 (position 30231228)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28068366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCCAGTTCCTCTAGTAGCACTAGCATCTCTGATCTTAGTGGGGATTG[G/A]TCATCTAATTGCCAAATTAAACCATCACCTACGAGACAGAGCCAGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Nonsense 945 1271 4 4
ENSDART00000133696   None 89 None 2
Genomic Location (Zv9):
Chromosome 16 (position 30231458)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28068596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAAGGAAGATGTTACACACAAGATTAACACAATCGCAGCAGATCCAT[T/A]GGTTGAGAAGGATTCTAAATTAAAGAAAGGACATTTTCTCTCACTTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10089
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127080 Nonsense 1160 1271 4 4
ENSDART00000133696   None 89 None 2
Genomic Location (Zv9):
Chromosome 16 (position 30232103)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28069241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTCTCCAACCTCCTCTATCATTCCTCACCSWTCCCCTGTTACCCTCT[T/G]ACCTACCATTCATCACTCYCTTTCTCTGCCCCATTTTGCCCCTTCGATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Anorexia nervosa: A genome-wide association study on common SNPs and rare CNVs in anorexia nervosa. (View Study)
  • Dental caries: Genome-wide association scan of dental caries in the permanent dentition. (View Study)
  • Hypothyroidism: Novel associations for hypothyroidism include known autoimmune risk loci. (View Study)
  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link