scg3

Ensembl ID:
ENSDARG00000086288
ZFIN ID:
ZDB-GENE-040426-1725
Description:
secretogranin III [Source:RefSeq peptide;Acc:NP_957051]
Human Orthologue:
SCG3
Human Description:
secretogranin III [Source:HGNC Symbol;Acc:13707]
Mouse Orthologue:
Scg3
Mouse Description:
secretogranin III Gene [Source:MGI Symbol;Acc:MGI:103032]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43156 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122930 Nonsense 44 478 2 12
Genomic Location (Zv9):
Chromosome 18 (position 37908265)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39489968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATCTAGACAAGTACAACCGTGAGCTGACTGAAGAGAAGCCTTTAGAA[C/T]AGCAGGTGTGATTTTGCTAATCTTAACTTTGTCATAAAACACAGAAATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Genome-wide association study of asthma identifies RAD50-IL13 and HLA-DR/DQ regions. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link