LOC100329499

Ensembl ID:
ENSDARG00000086274
Human Orthologue:
UNC13B
Human Description:
unc-13 homolog B (C. elegans) [Source:HGNC Symbol;Acc:12566]
Mouse Orthologue:
Unc13b
Mouse Description:
unc-13 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1342278]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21703 Nonsense Available for shipment Available now
sa21702 Nonsense Available for shipment Available now
sa21701 Nonsense Available for shipment Available now
sa31774 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126832 Nonsense 26 1534 2 38
Genomic Location (Zv9):
Chromosome 10 (position 17215642)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16977534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTCTCATCGTGGAGGTGTGGAACAAAGGGCTCATCTGGGACACCATGT[T/A]AGGAACTGCCTGGATCCCACTGAAAAACATCTGCCATTCAGACGAGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126832 Nonsense 399 1534 12 38
Genomic Location (Zv9):
Chromosome 10 (position 17174580)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17018506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCACTTTAATTTCAATCTCCTTTACTTCAACAGAAGAACCATGTGTA[T/A]AAGAAAACTCTACAAGCTTTAATCTACCCCATTTCTTGTACCACACCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126832 Nonsense 536 1534 13 38
Genomic Location (Zv9):
Chromosome 10 (position 17173182)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17019904
KASP Assay ID:
2260-3082.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCAGATGAAAACCATCAAGCAGAGTGTCCTAGATGGGACCTCCAAGT[G/A]GTCAGCCAAGATCACCATCACAGGTTCAAACACTGATCATTTACATTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126832 Essential Splice Site 1006 1534 24 38
Genomic Location (Zv9):
Chromosome 10 (position 17154097)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17038989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGAAGGATCTGCCTGCCTTTAAGGGAATAGTGCCCGAATATCCCAC[G/A]TGAGTGAGCTCTTCATTTCAAACATCAAAAAACACTCTTTTTGCATTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Parkinson's disease: Genome-wide association study identifies candidate genes for Parkinson's disease in an Ashkenazi Jewish population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link