LOC562872

Ensembl ID:
ENSDARG00000086272
Human Orthologue:
ZPLD1
Human Description:
zona pellucida-like domain containing 1 [Source:HGNC Symbol;Acc:27022]
Mouse Orthologue:
Zpld1
Mouse Description:
zona pellucida like domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2443415]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11304 Nonsense Available for shipment Available now
sa42523 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127368 Nonsense 81 387 2 10
Genomic Location (Zv9):
Chromosome 15 (position 18544467)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19748016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAATCTCTAATGGCACTCAATGCCAGGTTTGGCATCCCCGACTGTCGT[G/T]GAGTAGCAGACTGGTCTTCCAGTCCTCCTGTCTTGATGTTTAACTTCTCK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127368 Nonsense 163 387 3 10
Genomic Location (Zv9):
Chromosome 15 (position 18543565)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19748918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTTACAGACAACAACTAACCTACCAGTTCTCCTGCGTATATCCACTG[C/T]AGTATTTAGTCAACAACACTGAGGTCAAAGTGTGAGTATCATTCACAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link