ACYP2

Ensembl ID:
ENSDARG00000086271
Description:
acylphosphatase 2, muscle type [Source:HGNC Symbol;Acc:180]
Human Orthologue:
ACYP2
Human Description:
acylphosphatase 2, muscle type [Source:HGNC Symbol;Acc:180]
Mouse Orthologue:
Acyp2
Mouse Description:
acylphosphatase 2, muscle type Gene [Source:MGI Symbol;Acc:MGI:1922822]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9872 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125368 Essential Splice Site 44 87 1 3
Genomic Location:
Chromosome 11 (position 44258123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTGACAAATATGTGTCTGTAGATTTCGAGGTGTTCGGGAATGTTCAGG[G/T]TRGGTGTCTCAGTGTGTTTTRCAAACTTGGCGACCACGCCTCCAAAAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5r5z4e2q