ndst2a

Ensembl ID:
ENSDARG00000086269
ZFIN ID:
ZDB-GENE-060810-182
Human Orthologue:
NDST2
Human Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 [Source:HGNC Symbol;Acc:7681]
Mouse Orthologue:
Ndst2
Mouse Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 Gene [Source:MGI Symbol;Acc:MGI:97040]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18319 Nonsense Available for shipment Available now
sa31923 Nonsense Available for shipment Available now
sa9909 Essential Splice Site Available for shipment Available now
sa17386 Splice Site, Nonsense Available for shipment Available now
sa35466 Nonsense Available for shipment Available now
sa24930 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125149 Nonsense 293 894 1 14
Genomic Location (Zv9):
Chromosome 13 (position 22206299)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21935637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAYGATGGCATTCAAAGGGTGCTTTTYGGCAACAATCTKTCATTTTG[G/A]CTGCACAAGTTGATTTTTGTGGATGCCATAGCCTATCTGACAGGAAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125149 Nonsense 391 894 3 14
Genomic Location (Zv9):
Chromosome 13 (position 22218754)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21948092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGATGAAGGAGATGACATGCTGCTGCAGCACCGGCATGAGTTCTGGTG[G/A]TTTCCACACATGTGGAGTCACATGCAGCCTCACCTCTTTCACAATGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125149 Essential Splice Site 621 894 7 14
Genomic Location (Zv9):
Chromosome 13 (position 22227088)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21956426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGTGATCGGCTGCCCAAATTTCTGGTTGTTGGCCCACAGAAAACAGG[T/A]CAGTCTTACYATTTCCAGAYTCAAAGAMTAAAATYATTATGGATTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125149 Splice Site, Nonsense 662 894 9 14
Genomic Location (Zv9):
Chromosome 13 (position 22227618)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21956956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCTCTTRAAGCATATYTGCAGTTACCGAGKGTCTTGATYTCTCGCAG[G/A]TACATGGACTTCTTTCCCTTCCCCTCAAATGTCAGCACAGACTTCATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125149 Nonsense 816 894 12 14
Genomic Location (Zv9):
Chromosome 13 (position 22231065)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21960403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACGGCATCCAGCGCTTTTTGGGGATCACCCCAATATTCAACTACACC[C/T]AAGCTCTTGTGTGAGTCCTGCTGTTGCTCTCATCTCCTTGCTCTATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125149 Nonsense 875 894 14 14
Genomic Location (Zv9):
Chromosome 13 (position 22235009)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 21964347
KASP Assay ID:
554-7734.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGGAGTATTACCGGGAGCACAACCTGGAACTGCTGCGGCTGCTGAAT[C/T]GATTGGGACAGGCGTTACCCTCCTGGCTCAGAGAAGAGCTCCAGAGCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link