ENSDARG00000086260

Ensembl ID:
ENSDARG00000086260
Human Orthologue:
AC010904.1
Mouse Orthologues:
4933415A04Rik, Gm10217
Mouse Descriptions:
predicted gene 10217 Gene [Source:MGI Symbol;Acc:MGI:3642099]
RIKEN cDNA 4933415A04 gene Gene [Source:MGI Symbol;Acc:MGI:1922977]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4874 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101226 Nonsense 292 336 2 2
Genomic Location:
Chromosome 1 (position 60194186)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACTCCATCTCRGCTCTGGGTCAGTCGTGTGTGGGTTTGAGCACWGCA[C/T]AGATCAGCACCTCTACAGGCAGTGTCCTGCTGGGGGCGCTGTCACTGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ste7yavc