si:ch211-236p5.2

Ensembl ID:
ENSDARG00000086256
ZFIN ID:
ZDB-GENE-081028-33
Human Orthologue:
NLRC5
Human Description:
NLR family, CARD domain containing 5 [Source:HGNC Symbol;Acc:29933]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36322 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128105 Nonsense 13 959 1 8
ENSDART00000145668 Nonsense 14 639 1 1
Genomic Location (Zv9):
Chromosome 17 (position 8117617)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8120391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTTCTGCAGACTGAAGAGAGATGCTGCTGTCAGATCAGTGACTGAC[C/T]AACACAAATCATCCATGAAGGACAAATACGAGTTATTTGAGGGAATCAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link