ENSDARG00000086250

Ensembl ID:
ENSDARG00000086250
Human Orthologue:
PRKCA
Human Description:
protein kinase C, alpha [Source:HGNC Symbol;Acc:9393]
Mouse Orthologue:
Prkca
Mouse Description:
protein kinase C, alpha Gene [Source:MGI Symbol;Acc:MGI:97595]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33099 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130154 Essential Splice Site 100 312 3 8
Genomic Location (Zv9):
Chromosome 3 (position 10867059)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56209079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCATCCGCTCCTCGCTCAACCCCACCTGGAACGAGTCCTTCATCTTG[T/A]GAGTCTGAGCTAAACACACATACACACATACTTGTTTGATTTATGAGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association study of body height in African Americans: the Women's Health Initiative SNP Health Association Resource (SHARe). (View Study)
  • Ventricular conduction: Common variants in 22 loci are associated with QRS duration and cardiac ventricular conduction. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link