tmem176l.1

Ensembl ID:
ENSDARG00000086230
ZFIN ID:
ZDB-GENE-080829-11

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7299 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18185 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121522 Essential Splice Site 96 235 None 6
ENSDART00000132112 Essential Splice Site 96 236 None 7
ENSDART00000136568 Essential Splice Site 96 236 None 7
ENSDART00000145814 Essential Splice Site 96 236 None 7

The following transcripts of ENSDARG00000086230 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 49585462)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTGGAACAACCTTACTGGTTGTGATGCTGTTTTTTGGTTCGGTGGTACGG[T/C]AAGAATTAATGTCTTWTTCTTCTCCTTTTAAATATTTGATGTAGAGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121522 Nonsense 153 235 4 6
ENSDART00000132112 Nonsense 153 236 5 7
ENSDART00000136568 Nonsense 153 236 5 7
ENSDART00000145814 Nonsense 153 236 5 7

The following transcripts of ENSDARG00000086230 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 49584178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCAATAGACCTGGYCAGKGGAAATTATCTATACWGCRATGATTATTA[T/G]GATTMTTCAACACCTTCCCCTGAACAGAGGAGTGATAGAGAGACCTGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gjl20wfc