si:ch211-226h8.4

Ensembl ID:
ENSDARG00000086221
ZFIN IDs:
ZDB-GENE-050208-376, ZDB-GENE-070822-31, ZDB-GENE-070822-31
Description:
hypothetical protein LOC562338 [Source:RefSeq peptide;Acc:NP_001103858]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa374 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105308 Nonsense 69 153 3 6
ENSDART00000130250 Nonsense 65 149 3 6

The following transcripts of ENSDARG00000086221 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25657414)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25157320
KASP Assay ID:
554-0246.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCAGAAACTGTAAATGCATGTGAAGGCTCTATCCTGCGTCTGTCCTG[T/A]CCTGGTAAGATGAAGTCGCAATCCATTAAATAAGTGTTTTGCAAATTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link