LOC798577

Ensembl ID:
ENSDARG00000086214

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40849 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20876 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126011 Essential Splice Site 83 155 1 4
Genomic Location (Zv9):
Chromosome 7 (position 15510257)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14387425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGTAACAATAATGACATTGAAGAGCTCTTCAGGAACATCACGTCCAT[G/T]TAAGTGAGCTTCTGTGCGTCCCTACTGCGCAAAAATGTAGATATGTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126011 Essential Splice Site 108 155 2 4
Genomic Location (Zv9):
Chromosome 7 (position 15559447)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14436615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATTCTTAGGGATGTCGACATGGAGCTCTACACAGGACTCCAGAGACT[G/A]TGAGTATTCAAAAACTGATCCAATCAATGTGTTTTACATTGAAATCTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link