grin2da

Ensembl ID:
ENSDARG00000086207
ZFIN ID:
ZDB-GENE-041008-124
Description:
Novel protein similar to vertebrate glutamate receptor, ionotropic, N-methyl D-aspartate 2D (GRIN2D)
Human Orthologue:
GRIN2D
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2D [Source:HGNC Symbol;Acc:4588]
Mouse Orthologue:
Grin2d
Mouse Description:
glutamate receptor, ionotropic, NMDA2D (epsilon 4) Gene [Source:MGI Symbol;Acc:MGI:95823]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36789 Nonsense Mutation detected in F1 DNA During 2016
sa36788 Nonsense Mutation detected in F1 DNA During 2016
sa13750 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081313 Nonsense 123 364 2 6
ENSDART00000121651   None 554 None 3
ENSDART00000128837 Nonsense 337 1886 3 13
Genomic Location (Zv9):
Chromosome 19 (position 10612720)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10071259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCCAAGGCTCTGTTCGCTGTGCGACCCCAAGGATGGAGGGACGAGCCA[C/T]GACGGCGGATCGCAAAAGGTGTATCAGTACTGACGCACGGTGCTATGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081313   None 364 None 6
ENSDART00000121651 Nonsense 79 554 3 3
ENSDART00000128837 Nonsense 917 1886 13 13
Genomic Location (Zv9):
Chromosome 19 (position 10540207)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9998746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTAAATAAATTTTTCGCTTGTTATCTCTTACAGGGAATGTACAGCTG[C/A]TGCAATTTCGAGGATGAAACAGCTCCTGGAGGTTCCCAAAGCACACTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081313   None 364 None 6
ENSDART00000121651 Nonsense 132 554 3 3
ENSDART00000128837 Nonsense 970 1886 13 13
Genomic Location (Zv9):
Chromosome 19 (position 10540050)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9998589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCTGTGGCCAATCCCCCTATTGCTATGGCACAACAACTGCCGCARCAG[C/T]AACAAAAGCAACACCACCAGCAGCCACCAGTCTACAGTGCTCTTCTTYCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link