grin2da

Ensembl ID:
ENSDARG00000086207
ZFIN ID:
ZDB-GENE-041008-124
Description:
Novel protein similar to vertebrate glutamate receptor, ionotropic, N-methyl D-aspartate 2D (GRIN2D)
Human Orthologue:
GRIN2D
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2D [Source:HGNC Symbol;Acc:4588]
Mouse Orthologue:
Grin2d
Mouse Description:
glutamate receptor, ionotropic, NMDA2D (epsilon 4) Gene [Source:MGI Symbol;Acc:MGI:95823]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4789 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13750 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081313 None None 364 None 6
ENSDART00000121651 Essential Splice Site 74 554 2 3
ENSDART00000128837 Essential Splice Site 912 1886 12 13
Genomic Location:
Chromosome 19 (position 10541595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTTTAGGCCGGACAAGAGGACTTGACTTCTTACTGGCTTTTAGTCGG[G/A]TGAGTGTCCCTAATAAATCTTGTTGTACTATAAATGTTAGAGCTGCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081313 None None 364 None 6
ENSDART00000121651 Nonsense 132 554 3 3
ENSDART00000128837 Nonsense 970 1886 13 13
Genomic Location:
Chromosome 19 (position 10540050)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCTGTGGCCAATCCCCCTATTGCTATGGCACAACAACTGCCGCARCAG[C/T]AACAAAAGCAACACCACCAGCAGCCACCAGTCTACAGTGCTCTTCTTYCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6iondg41