LOC100332827

Ensembl ID:
ENSDARG00000086196

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22944 Nonsense Mutation detected in F1 DNA During 2014
sa16164 Nonsense Available for shipment Available now
sa16366 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121974 Nonsense 208 397 4 4
Genomic Location:
Chromosome 16 (position 49988191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACTCTGCGCCAGGATCAGATTGCCCACCCAATCTGTGTCAGTCCTC[A/T]AAATTCGTGAAACCCTCAAAGACCAGCCATACTGTACTCCAGTGTCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121974 Nonsense 315 397 4 4
ENSDART00000121974 Nonsense 315 397 4 4
Genomic Location:
Chromosome 16 (position 49987869)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCCCAATGGCAAATCAGAAGTGGAGTCCTCTTSCTCCTAAGRTGGAGT[T/G]AAATAARCCTAATTTGTATTATCGGCAGGACCCACCTCARCAGAGAGMTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121974 Nonsense 315 397 4 4
ENSDART00000121974 Nonsense 315 397 4 4
Genomic Location:
Chromosome 16 (position 49987869)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCCCAATGGCAAATCAGAAGTGGAGTCCTCTTSCTCCTAAGRTGGAGT[T/G]AAATAARCCTAATTTGTATTATCGGCAGGACCCACCTCARCAGAGAGMTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c0zc3vmu