mgp

Ensembl ID:
ENSDARG00000086189
ZFIN ID:
ZDB-GENE-060928-1
Description:
matrix Gla protein [Source:RefSeq peptide;Acc:NP_991203]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39971 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122143 Nonsense 95 105 4 4
Genomic Location (Zv9):
Chromosome 3 (position 2221804)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1658099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGCGCTACGGTTCTCAGGTGGCCTATCAGACCTTCTTCAGCCCGCAG[C/T]AGCTCAGGGCCAATCAGCAGCTGCGCAGATACTGAGCCCCGCCTCCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link