LOC100002138

Ensembl ID:
ENSDARG00000086186
Human Orthologue:
OPN5
Human Description:
opsin 5 [Source:HGNC Symbol;Acc:19992]
Mouse Orthologue:
Opn5
Mouse Description:
opsin 5 Gene [Source:MGI Symbol;Acc:MGI:2662912]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6648 Nonsense Mutation detected in F1 DNA During 2014
sa9326 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128696 Nonsense 65 285 1 4
Genomic Location:
Chromosome 20 (position 44484285)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATCGCYTCTGCTTTCAACCATGCGTGGATTGGTGGTGACCCGTCCTG[T/A]CTGTWTTATGGCCTGATGGGTATKMTTTTCAGCGTGGCCAGCATTATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128696 Nonsense 88 285 1 4
Genomic Location:
Chromosome 20 (position 44484353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTATKMTTTTCAGCGTGGCCAGCATTATGACTCTTGCTGTCATGGGGT[T/A]GGTGAGATATCTTGTGACAGGAAACCCTCCAAAATCAGGTATGATATAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6xtbc3t8