LOC100002138

Ensembl ID:
ENSDARG00000086186
Human Orthologue:
OPN5
Human Description:
opsin 5 [Source:HGNC Symbol;Acc:19992]
Mouse Orthologue:
Opn5
Mouse Description:
opsin 5 Gene [Source:MGI Symbol;Acc:MGI:2662912]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6648 Nonsense Mutation detected in F1 DNA During 2016
sa9326 Nonsense Mutation detected in F1 DNA During 2016
sa37144 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128696 Nonsense 65 285 1 4
Genomic Location (Zv9):
Chromosome 20 (position 44484285)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 44382179
KASP Assay ID:
554-4412.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATCGCYTCTGCTTTCAACCATGCGTGGATTGGTGGTGACCCGTCCTG[T/A]CTGTWTTATGGCCTGATGGGTATKMTTTTCAGCGTGGCCAGCATTATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128696 Nonsense 88 285 1 4
Genomic Location (Zv9):
Chromosome 20 (position 44484353)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 44382247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTATKMTTTTCAGCGTGGCCAGCATTATGACTCTTGCTGTCATGGGGT[T/A]GGTGAGATATCTTGTGACAGGAAACCCTCCAAAATCAGGTATGATATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128696 Splice Site, Nonsense 206 285 3 4
Genomic Location (Zv9):
Chromosome 20 (position 44490551)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 44388445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGCTTTTTCCACCTTTTCTGTATTAGATCTCCTTGTTTATTTGTAAT[C/A]AAAAGTCTGCTATATCATGCAAAAAAAAATAAGTTCTGTCAAAAGTTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link