LOC100331105

Ensembl ID:
ENSDARG00000086172
Human Orthologue:
ACVR1C
Human Description:
activin A receptor, type IC [Source:HGNC Symbol;Acc:18123]
Mouse Orthologue:
Acvr1c
Mouse Description:
activin A receptor, type IC Gene [Source:MGI Symbol;Acc:MGI:2661081]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25414 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129308 Nonsense 83 369 2 6
Genomic Location:
Chromosome 9 (position 5314073)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGGTCAGGTGTTCTGCTACAGCTCCAGAAATGTCTCCAAGCGCAACTG[C/A]TGCTTCACAGACTTCTGCAACAATGAAACACTGCACCTCAATCCAGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t79v6c5z