LOC797951

Ensembl ID:
ENSDARG00000086162
Human Orthologue:
ZNF385D
Human Description:
zinc finger protein 385D [Source:HGNC Symbol;Acc:26191]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36261 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127513 Essential Splice Site 9 411 1 8
Genomic Location (Zv9):
Chromosome 16 (position 53402693)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 49672673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACACCACCGATTTGGACGTGTGATGACCATGGAGAGCATGTTTATCGG[T/C]GAGTACAGTCTGCTTCTTTGAAAGTCTGTGGTTTTGTTTGTTAGACTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link