TMPRSS7

Ensembl ID:
ENSDARG00000086161
Description:
transmembrane protease, serine 7 [Source:HGNC Symbol;Acc:30846]
Human Orthologue:
TMPRSS7
Human Description:
transmembrane protease, serine 7 [Source:HGNC Symbol;Acc:30846]
Mouse Orthologue:
Tmprss7
Mouse Description:
transmembrane serine protease 7 Gene [Source:MGI Symbol;Acc:MGI:2686594]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9804 Nonsense Available for shipment Available now
sa24499 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129558 Nonsense 502 785 14 19
ENSDART00000130197 Nonsense 501 780 14 19
Genomic Location:
Chromosome 24 (position 22455634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTATGTTCTGTAATTAATATGTTTGATGTGCAGAGACTAGCTGTTCT[G/T]GAGTCAGTTATCAGTGTGACAATGGAGCCTGCATTCTTAAGAAAAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129558 Essential Splice Site 594 785 17 19
ENSDART00000130197 Essential Splice Site 589 780 17 19
Genomic Location:
Chromosome 24 (position 22453520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACATTTTGTTAGTGTTTTCATACAGCATGTGTGATCTTTGATGCTTTC[A/G]GGTTGGCAGATCCACGTATGTGGATGGCTCATTTGGGAATGCTGAACCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6wojuhid