LOC798935

Ensembl ID:
ENSDARG00000086156
Human Orthologue:
SYNPO
Human Description:
synaptopodin [Source:HGNC Symbol;Acc:30672]
Mouse Orthologue:
Synpo
Mouse Description:
synaptopodin Gene [Source:MGI Symbol;Acc:MGI:1099446]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30420 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122237 Nonsense 142 494 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA403 (position 57036)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150129.1 57036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATATCCAACTCCTCCTCTTCCAAGCCATCCTGAAACTCATTCTCCAT[C/A]ACCCCGAGCTTCTTCCTTCTACATCCGGCCTTCAGTTCCGAGGCCTACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link