CELF5 (3 of 4)

Ensembl ID:
ENSDARG00000086155
Description:
CUGBP, Elav-like family member 5 [Source:HGNC Symbol;Acc:14058]
Human Orthologue:
CELF5
Human Description:
CUGBP, Elav-like family member 5 [Source:HGNC Symbol;Acc:14058]
Mouse Orthologue:
Celf5
Mouse Description:
CUGBP, Elav-like family member 5 Gene [Source:MGI Symbol;Acc:MGI:2442333]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39950 Nonsense Mutation detected in F1 DNA During 2017
sa39951 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126442 Nonsense 24 102 1 2
Genomic Location (Zv9):
Chromosome 2 (position 54003110)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53685953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATCTGGCTTCCTCCGCCGTGCCAAGCATCGTGACCCCAATAGTGAAC[G/T]GATTCAGCGGGATCCCGCACCAACCCAATGGTCATCCGGTGGAGGCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126442 Nonsense 73 102 2 2
Genomic Location (Zv9):
Chromosome 2 (position 54008353)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 53691196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCATCTGTCCCTCTTTCTCTTCCTCCTGTATGCTTGCGCAGCCATATA[T/A]CCTGCCACAACACTGACCCCTATAGGCCAGACACTGCCACAGCCTGCGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link