LOC100334118

Ensembl ID:
ENSDARG00000086150
Human Orthologue:
WRAP53
Human Description:
WD repeat containing, antisense to TP53 [Source:HGNC Symbol;Acc:25522]
Mouse Orthologue:
Wrap53
Mouse Description:
WD repeat containing, antisense to TP53 Gene [Source:MGI Symbol;Acc:MGI:2384933]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9964 Essential Splice Site Available for shipment Available now
sa14750 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129161 Essential Splice Site 204 534 4 10
Genomic Location:
Chromosome 7 (position 22092812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCCCAGCTGAGCTGTACAGCAGCCAATGGGACTTGCTTTCTGAGATG[G/A]TCAGTCTGCGTCAGATCTTCCTTTATAWTCATCTTTATGAGCCTAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129161 Essential Splice Site 204 534 4 10
Genomic Location:
Chromosome 7 (position 22092813)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCCAGCTGAGCTGTACAGCAGCCAATGGGACTTGCTTTCTGAGATGR[T/G]CAGTCTGCGTCAGATCTTCCTTTATAWTCATCTTTATGAGCCTAATAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j98jj6lp