LOC100334118

Ensembl ID:
ENSDARG00000086150
Human Orthologue:
WRAP53
Human Description:
WD repeat containing, antisense to TP53 [Source:HGNC Symbol;Acc:25522]
Mouse Orthologue:
Wrap53
Mouse Description:
WD repeat containing, antisense to TP53 Gene [Source:MGI Symbol;Acc:MGI:2384933]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9964 Essential Splice Site Available for shipment Available now
sa14750 Essential Splice Site Available for shipment Available now
sa26935 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa9964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129161 Essential Splice Site 204 534 4 10
Genomic Location:
Chromosome 7 (position 22092812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCCCAGCTGAGCTGTACAGCAGCCAATGGGACTTGCTTTCTGAGATG[G/A]TCAGTCTGCGTCAGATCTTCCTTTATAWTCATCTTTATGAGCCTAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129161 Essential Splice Site 204 534 4 10
Genomic Location:
Chromosome 7 (position 22092813)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCCAGCTGAGCTGTACAGCAGCCAATGGGACTTGCTTTCTGAGATGR[T/G]CAGTCTGCGTCAGATCTTCCTTTATAWTCATCTTTATGAGCCTAATAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129161 Essential Splice Site 309 534 7 10
Genomic Location:
Chromosome 7 (position 22103385)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGAATAATGTTACTGTTTTTTTTTCTCTTCATTTTGTATCTTCTGAA[G/A]TCAAGAAACGGGGTCAGACTGGCATTATTTCCTGCATTGCCTTCAGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j98jj6lp