ARHGAP27 (2 of 2)

Ensembl ID:
ENSDARG00000086142
Description:
Rho GTPase activating protein 27 [Source:HGNC Symbol;Acc:31813]
Human Orthologue:
ARHGAP27
Human Description:
Rho GTPase activating protein 27 [Source:HGNC Symbol;Acc:31813]
Mouse Orthologue:
Arhgap27
Mouse Description:
Rho GTPase activating protein 27 Gene [Source:MGI Symbol;Acc:MGI:1916903]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35202 Nonsense Mutation detected in F1 DNA During 2016
sa22021 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126361 Nonsense 729 970 11 17
Genomic Location (Zv9):
Chromosome 12 (position 5822476)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5000562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTGATAAATCTCCAACCTTAGACAGAGAGGAGAGACCATTTGAAAAG[A/T]GAACTATGAGCACCGGTAATGCATTCAGCTCCTCACATTCTGGATTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126361 Essential Splice Site 835 970 15 17
Genomic Location (Zv9):
Chromosome 12 (position 5817148)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5005890
KASP Assay ID:
2260-4906.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATTTTTTATTTTCTTCTGCGTCATTTTGTGTTTCTCTGTGTTTCTCC[A/T]GAGGATCTGGACCTGGAGGAGGGAAACTGGGATATTCATGTGATCACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link