ENSDARG00000086141

Ensembl ID:
ENSDARG00000086141
Human Orthologues:
ERN1, ERN2
Human Descriptions:
endoplasmic reticulum to nucleus signaling 1 [Source:HGNC Symbol;Acc:3449]
endoplasmic reticulum to nucleus signaling 2 [Source:HGNC Symbol;Acc:16942]
Mouse Orthologues:
Ern1, Ern2
Mouse Descriptions:
endoplasmic reticulum (ER) to nucleus signalling 1 Gene [Source:MGI Symbol;Acc:MGI:1930134]
endoplasmic reticulum (ER) to nucleus signalling 2 Gene [Source:MGI Symbol;Acc:MGI:1349436]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16988 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123453 Nonsense 698 822 2 4
Genomic Location:
Chromosome 7 (position 75098874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATKCTGGAAGGCAAAGGAGACCATAGATGAGGAGGKCARCACTGGGTA[C/A]AAGAGGAGCTCCGACATTCAGGTGTRTTTCAAGTATTAATCAATGAACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/10pbnl9r