ENSDARG00000086121

Ensembl ID:
ENSDARG00000086121
Human Orthologue:
MUC7
Human Description:
mucin 7, secreted [Source:HGNC Symbol;Acc:7518]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6864 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123078 Essential Splice Site 69 343 3 3
Genomic Location:
Chromosome 2 (position 47683750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATTCACCTGACCTAACTTACCATAAATTAATACCTGCTTATATTTTTC[A/T]GATTCCTCACAAKCAACCTTAGSACCTTCTTCAGAAACATCTTTTCCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3724b0fh