si:ch211-266i6.3

Ensembl ID:
ENSDARG00000086112
ZFIN ID:
ZDB-GENE-030131-5420
Human Orthologue:
CKAP2
Human Description:
cytoskeleton associated protein 2 [Source:HGNC Symbol;Acc:1990]
Mouse Orthologue:
Ckap2
Mouse Description:
cytoskeleton associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:1931797]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8538 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122147 Nonsense 25 610 2 6
ENSDART00000137373 Nonsense 25 610 3 7
Genomic Location (Zv9):
Chromosome 10 (position 33007230)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32108579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTCAGAGAAACAAGGAGAACACTAAACCAGTTTCTGRCCTTAAAAAA[C/T]AAGTCATCAGCAGTACTGYATCAAAACAAAGAGTCCTATGTAAAACGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link