si:ch73-72b7.1

Ensembl ID:
ENSDARG00000086109
ZFIN ID:
ZDB-GENE-100921-23
Human Orthologue:
UNC5C
Human Description:
unc-5 homolog C (C. elegans) [Source:HGNC Symbol;Acc:12569]
Mouse Orthologue:
Unc5c
Mouse Description:
unc-5 homolog C (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1095412]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8687 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38449 Essential Splice Site Mutation detected in F1 DNA During 2017
sa5282 Nonsense F2 line generated During 2017
sa38448 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30857 Nonsense Mutation detected in F1 DNA During 2017
sa40361 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131156 Essential Splice Site 49 509 1 8
ENSDART00000131473 Essential Splice Site 175 620 3 10

The following transcripts of ENSDARG00000086109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 8879132)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 6944062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGCTGAACGGCGGATTTCAGCCTGTCAGCATCAAACAAGCACGATCAG[G/A]TGACMCCTTCACACCTCWCTGCAYTGAAAACAAATCACTCACTGGNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131156 Essential Splice Site 198 509 3 8
ENSDART00000131473 Essential Splice Site 324 620 5 10

The following transcripts of ENSDARG00000086109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 8866104)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 6957090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGAGTGTATGAGATGTATGTGAGCTTACAGAGGACAGAAAGCATGAGG[T/G]AAGACAAAAACACACAACCCACTTACTAAACACACATTCAGGATTCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5282
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131156 Nonsense 375 509 6 8
ENSDART00000131473 Nonsense 501 620 8 10

The following transcripts of ENSDARG00000086109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 8855136)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 6968058
KASP Assay ID:
554-3501.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCACAACTTGAGACTGTCAGTCCACGATATCCACTGCCAGTGGAGGAGC[A/T]AACTTCTGACCAAATACCAGGTACAACACAACACACTCACCACCTTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131156 Essential Splice Site 381 509 None 8
ENSDART00000131473 Essential Splice Site 507 620 None 10

The following transcripts of ENSDARG00000086109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 8855114)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 6968080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGATATCCACTGCCAGTGGAGGAGCAAACTTCTGACCAAATACCAGG[T/C]ACAACACAACACACTCACCACCTTCACTGAAGTAAACAGTATGAATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131156   483 509 8 8
ENSDART00000131473 Nonsense 608 620 10 10
ENSDART00000131156   483 509 8 8
ENSDART00000131473 Nonsense 608 620 10 10

The following transcripts of ENSDARG00000086109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 8844403)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 6978791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGAAACAAACTGTGCAGCAGTCTGGACGCACCACACACACGCGGAAA[C/T]GACTGGAGGAAACTGGCTCACAAACTACAGCTCGACAGGTCATTGCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131156   483 509 8 8
ENSDART00000131473 Nonsense 608 620 10 10
ENSDART00000131156   483 509 8 8
ENSDART00000131473 Nonsense 608 620 10 10

The following transcripts of ENSDARG00000086109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 8844403)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 6978791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGAAACAAACTGTGCAGCAGTCTGGACGCACCACACACACGCGGAAA[C/T]GACTGGAGGAAACTGGCTCACAAACTACAGCTCGACAGGTCATTGCACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • T-tau: Genome-wide association reveals genetic effects on human Aβ42 and τ protein levels in cerebrospinal fluids: a case control study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link