LOC100333685

Ensembl ID:
ENSDARG00000086100
Human Orthologue:
CD302
Human Description:
CD302 molecule [Source:HGNC Symbol;Acc:30843]
Mouse Orthologue:
Cd302
Mouse Description:
CD302 antigen Gene [Source:MGI Symbol;Acc:MGI:1913455]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21606 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125850 Essential Splice Site 79 251 2 7
Genomic Location:
Chromosome 9 (position 53149865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAAAAGCTACTCTCTTCAAGATGCTAAAGACATGTGCAGAGGATATGG[T/C]AGTTTTTACCTTTTGCAAACTCTAAACCAGGGGTCACCAATCTTGGTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4duy8nn6