LOC566587

Ensembl ID:
ENSDARG00000086098
Human Orthologue:
ERRFI1
Human Description:
ERBB receptor feedback inhibitor 1 [Source:HGNC Symbol;Acc:18185]
Mouse Orthologue:
Errfi1
Mouse Description:
ERBB receptor feedback inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1921405]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43961 Nonsense Mutation detected in F1 DNA During 2017
sa39405 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127628 Nonsense 42 365 3 4
Genomic Location (Zv9):
Chromosome 23 (position 21129472)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20914016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTTTAGATTTGGTTCGGAGTCCATGGATCACAGCTTGAGAATGTAT[C/T]AGCAGAACTCTGCGAATGTGGGCTTTGAAAGTGAGTGAGTGCTTGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127628 Nonsense 313 365 4 4
Genomic Location (Zv9):
Chromosome 23 (position 21131747)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20916291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTCCTACTCAGAGCTTTGCTCCCTATCCGGAGTATGTCAGTAAGGCT[C/T]AACACAAGCAGATCTGTCAAGGCTTGCCTTCTCCTCGTAGTCCCTGTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link