Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC566587
- Ensembl ID:
- ENSDARG00000086098
- Human Orthologue:
- ERRFI1
- Human Description:
- ERBB receptor feedback inhibitor 1 [Source:HGNC Symbol;Acc:18185]
- Mouse Orthologue:
- Errfi1
- Mouse Description:
- ERBB receptor feedback inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1921405]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa43961 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa39405 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43961
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000127628 | Nonsense | 42 | 365 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 23 (position 21129472)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 20914016 GRCz11 23 20840359 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTTTTTAGATTTGGTTCGGAGTCCATGGATCACAGCTTGAGAATGTAT[C/T]AGCAGAACTCTGCGAATGTGGGCTTTGAAAGTGAGTGAGTGCTTGATATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39405
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000127628 | Nonsense | 313 | 365 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 23 (position 21131747)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 20916291 GRCz11 23 20842634 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCCTCCTACTCAGAGCTTTGCTCCCTATCCGGAGTATGTCAGTAAGGCT[C/T]AACACAAGCAGATCTGTCAAGGCTTGCCTTCTCCTCGTAGTCCCTGTATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
