ENSDARG00000086086

Ensembl ID:
ENSDARG00000086086
Human Orthologues:
TNPO1, TNPO2
Human Descriptions:
transportin 1 [Source:HGNC Symbol;Acc:6401]
transportin 2 [Source:HGNC Symbol;Acc:19998]
Mouse Orthologues:
Tnpo1, Tnpo2
Mouse Descriptions:
transportin 1 Gene [Source:MGI Symbol;Acc:MGI:2681523]
transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7569 Missense Mutation detected in F1 DNA During 2016
sa38487 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124887 Missense 19 128 1 4
Genomic Location:
Chromosome 5 (position 36870604)
KASP Assay ID:
554-4104.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCAGTGGAAACCCGACGAGCAGGGGCTTCAGCAGATCCTACAGCTGC[T/G]CAAGGAGTCACAGTCCCCGGATACATCAACGCAACGATCCGTCCAACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124887 Nonsense 23 128 1 4
Genomic Location:
Chromosome 5 (position 36870593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCGACGAGCAGGGGCTTCAGCAGATCCTACAGCTGCTCAAGGAGTCA[C/T]AGTCCCCGGATACATCAACGCAACGATCCGTCCAACAAGTATCCTTAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link