BACE2 (1 of 2)

Ensembl ID:
ENSDARG00000086067
Description:
beta-site APP-cleaving enzyme 2 [Source:HGNC Symbol;Acc:934]
Human Orthologue:
BACE2
Human Description:
beta-site APP-cleaving enzyme 2 [Source:HGNC Symbol;Acc:934]
Mouse Orthologue:
Bace2
Mouse Description:
beta-site APP-cleaving enzyme 2 Gene [Source:MGI Symbol;Acc:MGI:1860440]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12389 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130000 Nonsense 109 131 3 4
Genomic Location:
Chromosome 15 (position 6724125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCATGTTGGATGAGAGGAGAGTCACCATGGAGGTTTTTTCCAAAAGTCT[C/A]AATCTACCTCAGAGGAACGAACMCCAGCCAGTCCTTCAGAATCACTATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y1w2zc6r