ENSDARG00000086060

Ensembl ID:
ENSDARG00000086060
Human Orthologues:
HMCN2, RP11-88G17.6
Human Descriptions:
hemicentin 2 [Source:HGNC Symbol;Acc:21293]
Novel protein similar to hemicentin (LOC392395) [Source:UniProtKB/TrEMBL;Acc:A2A3K3]
Mouse Orthologue:
Hmcn2
Mouse Description:
hemicentin 2 Gene [Source:MGI Symbol;Acc:MGI:2677838]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13006 Nonsense Available for shipment Available now
sa5492 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126833 Nonsense 43 1126 1 22
Genomic Location:
Chromosome 8 (position 33471754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCAAAGACTATCGGCTGAAGAGAGACGTTCTCCAGTTAGTACAGCTA[C/T]GACAGTCTCAGGTACCTGTTTYAGTCTTATTGCAATTCTTTTACAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126833 Nonsense 744 1126 15 22
Genomic Location:
Chromosome 8 (position 33528008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTTTCTCTGATCCCTCCAGGTGTTTGGGTTGATGATGAAGGTGTTTA[T/A]CTTTGCGAGGCCAAAAACCAGTTCGGATCTATCAAGGCATTAGCGAGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/da8bmkgq