ENSDARG00000086060

Ensembl ID:
ENSDARG00000086060
Human Orthologues:
HMCN2, RP11-88G17.6
Human Descriptions:
hemicentin 2 [Source:HGNC Symbol;Acc:21293]
Novel protein similar to hemicentin (LOC392395) [Source:UniProtKB/TrEMBL;Acc:A2A3K3]
Mouse Orthologue:
Hmcn2
Mouse Description:
hemicentin 2 Gene [Source:MGI Symbol;Acc:MGI:2677838]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13006 Nonsense Available for shipment Available now
sa5492 Nonsense Mutation detected in F1 DNA During 2016
sa41251 Nonsense Mutation detected in F1 DNA During 2016
sa41252 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126833 Nonsense 43 1126 1 22
Genomic Location:
Chromosome 8 (position 33471754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCAAAGACTATCGGCTGAAGAGAGACGTTCTCCAGTTAGTACAGCTA[C/T]GACAGTCTCAGGTACCTGTTTYAGTCTTATTGCAATTCTTTTACAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126833 Nonsense 744 1126 15 22
Genomic Location:
Chromosome 8 (position 33528008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTTTCTCTGATCCCTCCAGGTGTTTGGGTTGATGATGAAGGTGTTTA[T/A]CTTTGCGAGGCCAAAAACCAGTTCGGATCTATCAAGGCATTAGCGAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126833 Nonsense 803 1126 16 22
Genomic Location:
Chromosome 8 (position 33528269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTTCCCTGTAGGTTATTAGATGGGATTCCTCTCCCTGAAAGGATCTG[G/A]ACACACAATGGGAAACAAGTGAGTAACAAAAATGAGTTCATTTCACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126833 Essential Splice Site 858 1126 18 22
Genomic Location:
Chromosome 8 (position 33530623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGGTTGTTAAGGTCTGGTCAACAGCTGCTATTTTGACCTACTTTTGC[A/T]GCCCCTCCTGATATCAAGGCTGGTCCCCTGCACTACACAGCTAGCGAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link