si:ch211-215m13.2

Ensembl ID:
ENSDARG00000086056
ZFIN ID:
ZDB-GENE-030131-2517
Human Orthologue:
PLEKHG6
Human Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 6 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Plekhg6
Mouse Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 6 Gene [Source:MGI Symbo

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36087 Essential Splice Site Available for shipment Available now
sa36086 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11583 Essential Splice Site Available for shipment Available now
sa39090 Splice Site Mutation detected in F1 DNA During 2017
sa28623 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121458 Essential Splice Site 7 1024 2 15
ENSDART00000133625 Essential Splice Site 14 150 2 4
Genomic Location (Zv9):
Chromosome 16 (position 19112022)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17142345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTGTTATTGGCTATTAATCATATTAATATAAACTTATCTATCTATTA[G/A]TAATCCATCAAATCCACAAGAAGTGAACAATGTCATGGCCCCGGAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121458 Essential Splice Site 214 1024 7 15
ENSDART00000133625   None 150 None 4
Genomic Location (Zv9):
Chromosome 16 (position 19105884)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17136207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAATCAATTAATCTTTTTCCATTTCTCTCTACATTTATTTCTTTTTTT[A/C]GGTTAGCCCCACGATGCTCTTTTCCGATCTTCCATCTATTCTCGATGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121458 Essential Splice Site 300 1024 8 15
ENSDART00000133625   None 150 None 4
Genomic Location (Zv9):
Chromosome 16 (position 19105519)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17135842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACGAAAACAGCTTGAGACGAACCCACAATTTWACACCTATCTCATGG[T/G]ATTTTATATCATATACCTWAGTTTATWAAAGGAAATGTTTAAAWAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121458 Splice Site None 1024 None 15
ENSDART00000133625   None 150 None 4
Genomic Location (Zv9):
Chromosome 16 (position 19094469)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17124792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACTGGAAGAAACTTTGAAGGTTAAAAGAAGAAAGGATACAAAGGCAA[G/T]TGACAAACTGACTATGATTCACTAATGATTATTATTTATTGGCCTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121458 Nonsense 998 1024 15 15
ENSDART00000133625   None 150 None 4
Genomic Location (Zv9):
Chromosome 16 (position 19069316)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17099639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGGAGTTTTTTGACTTTGAGGACTTAGATTATGAAAACTGGTTTGAA[C/T]AGTCACTCACCTCCAATGGAGTCCGCAGGTCAAAGACAAAACGATCGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link