IGFN1 (3 of 3)

Ensembl ID:
ENSDARG00000086028
Description:
immunoglobulin-like and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:24607]
Human Orthologue:
IGFN1
Human Description:
immunoglobulin-like and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:24607]
Mouse Orthologue:
Igfn1
Mouse Description:
immunoglobulin-like and fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:304

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7047 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11197 Nonsense Available for shipment Available now
sa14197 Nonsense Available for shipment Available now
sa20805 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123576 Essential Splice Site 134 1230 5 22
Genomic Location:
Chromosome 6 (position 46719702)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGCAATTAGATCTGKCATGTAAATGGTCATTATTTCTTCCATCTTTC[A/T]GTTGGATTCAAGAAAAAGCAAACTGAYGCATCCTCAAATAAAGGTGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123576 Nonsense 556 1230 12 22
Genomic Location:
Chromosome 6 (position 46717278)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACATCCATTTCAGMTGATAAATTGCACTTYGCAAGTGGGTTAACAGAC[A/T]AAAATGCCCTCCGTGGMAAACCAGCAGAGTTGGTGTGCAAACTTAGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123576 Nonsense 1224 1230 21 22
Genomic Location:
Chromosome 6 (position 46711331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGTACAAAGTGGTGGCSGTCAACTCACTTGGCAGAGCAGAGYGTTCTT[C/A]GACATTAAAAGTGAAAGGTATGACAGCTGCGGTGATCGTTTCTAGGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123576 Essential Splice Site 1230 1230 21 22
Genomic Location:
Chromosome 6 (position 46711312)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAACTCACTTGGCAGAGCAGAGTGTTCTTCGACATTAAAAGTGAAAGG[T/G]ATGACAGCTGCGGTGATCGTTTCTAGGCTTGAAAAACATTTACCACAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mhk7orqt