KIAA2026

Ensembl ID:
ENSDARG00000086023
Description:
KIAA2026 [Source:HGNC Symbol;Acc:23378]
Human Orthologue:
KIAA2026
Human Description:
KIAA2026 [Source:HGNC Symbol;Acc:23378]
Mouse Orthologue:
9930021J03Rik
Mouse Description:
RIKEN cDNA 9930021J03 gene Gene [Source:MGI Symbol;Acc:MGI:2444398]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23833 Nonsense Available for shipment Available now
sa37197 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129678 Nonsense 846 1301 2 2
Genomic Location (Zv9):
Chromosome 21 (position 1296606)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 1001007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCATCCCACAGGACTGCAAGTCCCAAGTACTGTTCATCCTAAAGGAT[T/A]GCAAGTCACAAGTGTGGCTCCTTCTGTAGGATTGCAAGCCCCAAGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129678 Nonsense 912 1301 2 2
Genomic Location (Zv9):
Chromosome 21 (position 1296804)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 1001205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCCTCCTGCAGTATTGCAAGTTCAAAGTCCTGTTTGTCCTGCAGGAT[T/A]GCAAGTCTCAAGCCCTGTTCATTCGGCAGGATTGCACGTCCCAAGTCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link