si:ch73-389o21.2

Ensembl ID:
ENSDARG00000083189
ZFIN ID:
ZDB-GENE-100922-157
Human Orthologue:
ARHGAP19
Human Description:
Rho GTPase activating protein 19 [Source:HGNC Symbol;Acc:23724]
Mouse Orthologue:
Arhgap19
Mouse Description:
Rho GTPase activating protein 19 Gene [Source:MGI Symbol;Acc:MGI:1918335]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37564 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30733 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116455 Essential Splice Site 130 454 3 12
ENSDART00000133537 Essential Splice Site 130 454 3 11
Genomic Location (Zv9):
Chromosome 22 (position 37809541)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34994421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGAAGGAATAGCCCAGATATATCAGCTCATCGCTTACCTCAGCAAAA[G/A]TAAGTGCATGATATTAATAAAGTTGATGGCTTTATTATACAGTTCACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000116455 Nonsense 301 454 6 12
ENSDART00000133537 Nonsense 301 454 6 11
Genomic Location (Zv9):
Chromosome 22 (position 37805680)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34990560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACCTGAAGAAGCTCAACAGCGGGATGGCGTTTCTCATCAAACACTCA[C/T]AGAAGATCTTTAGGGTATCTTTTCAGATCAAACCTTTTCTCACTGCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link