RNF138

Ensembl ID:
ENSDARG00000081322
Description:
ring finger protein 138 [Source:HGNC Symbol;Acc:17765]
Human Orthologues:
RNF125, RNF138
Human Descriptions:
ring finger protein 125 [Source:HGNC Symbol;Acc:21150]
ring finger protein 138 [Source:HGNC Symbol;Acc:17765]
Mouse Orthologues:
Rnf125, Rnf138
Mouse Descriptions:
ring finger protein 125 Gene [Source:MGI Symbol;Acc:MGI:1914914]
ring finger protein 138 Gene [Source:MGI Symbol;Acc:MGI:1929211]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16816 Nonsense Available for shipment Available now
sa23634 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000117777 Nonsense 333 343 9 9
Genomic Location:
Chromosome 20 (position 6592600)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGWGATTTCCRATCCGCAGCCCCTCCAGCAGTCCGATGAGGTGAATCTG[C/T]AGCTYGCGCTTATGGCGTCWTATCAACAACATTAAACCGCATTTTCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000117777 Nonsense 340 343 9 9
Genomic Location:
Chromosome 20 (position 6592623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCAGTCCGATGAGGTGAATCTGCAGCTCGCGCTTATGGCGTCTTA[T/A]CAACAACATTAAACCGCATTTTCAGTTCTCAGACATGGTCTGGACAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/som09iml