il13ra1

Ensembl ID:
ENSDARG00000080020
ZFIN ID:
ZDB-GENE-060503-103
Description:
interleukin 13 receptor, alpha 1 [Source:RefSeq peptide;Acc:NP_001104307]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20895 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112447 Essential Splice Site 27 411 1 10
ENSDART00000134788 Essential Splice Site 27 312 1 7
Genomic Location:
Chromosome 7 (position 20379180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGCTTCTCCGTCTCGCTCATGTTCGTCGGTGTTGAAAGCATGTCAG[G/A]TGGGTTCACTTCTGTTTTGTTCGTAAATGTCAGTAACTATCCTGAAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hxst906t